This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011905


Marker Name:  MNS0087 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: ACATGGAAACAACCTAAGAAGG
Primer: AGGCAACTGCAAATATGATCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF259760

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
148.900 148.900 148.900
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
143.600 143.600 143.600
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
154.100 154.100 154.100
SM4.2 Framework (A): 2 Sheep
chromosome 2
150.000 150.000 150.000
SM4.2 Framework (F): 2 Sheep
chromosome 2
145.600 145.600 145.600
SM4.2 Framework (M): 2 Sheep
chromosome 2
155.000 155.000 155.000


© The Roslin Institute 2007-2012, all rights reserved