This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011827


Marker Name:  MNS0009 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: CAAATTGCTCTGCTTTTCTATTC
Primer: CACTACAACACCATCTCTTTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF259683

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4.2 Framework (A): X Sheep
chromosome X
46.100 46.100 46.100
SM4.2 Framework (F): X Sheep
chromosome X
36.100 36.100 36.100


© The Roslin Institute 2007-2012, all rights reserved