This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011787


Marker Name:  MCMA0022 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CAGGGCCATAGCTGTAAAGC
Primer: GATGGAAGTAAGGGAGAATTGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
116.500 116.500 116.500
SM3 Best Positions (A): 6 Sheep
chromosome 6
120.100 120.100 120.100
SM3 Best Positions (F): 6 Sheep
chromosome 6
102.100 102.100 102.100
SM3 Best Positions (M): 6 Sheep
chromosome 6
137.300 137.300 137.300
SM3 Framework (F): 6 Sheep
chromosome 6
98.700 98.700 98.700
SM3 Framework (M): 6 Sheep
chromosome 6
133.400 133.400 133.400
SM4 Best Positions (A): 6 Sheep
chromosome 6
118.700 118.700 118.700
SM4 Framework (A): 6 Sheep
chromosome 6
112.400 112.400 112.400
SM4 Framework (F): 6 Sheep
chromosome 6
94.100 94.100 94.100
SM4 Framework (M): 6 Sheep
chromosome 6
128.900 128.900 128.900
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
118.700 118.700 118.700
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
101.700 101.700 101.700
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
134.500 134.500 134.500
SM4.2 Framework (A): 6 Sheep
chromosome 6
115.500 115.500 115.500
SM4.2 Framework (F): 6 Sheep
chromosome 6
98.500 98.500 98.500
SM4.2 Framework (M): 6 Sheep
chromosome 6
130.800 130.800 130.800


© The Roslin Institute 2007-2012, all rights reserved