This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011784


Marker Name:  MCMA0018 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AAGGAGAGATAAATTATGAGTG
Primer: TTTACAATGTGTTAATTTCAAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 10 Sheep
chromosome 10
42.600 42.600 42.600
SM3 Best Positions (A): 10 Sheep
chromosome 10
42.500 42.500 42.500
SM3 Best Positions (F): 10 Sheep
chromosome 10
39.300 39.300 39.300
SM3 Best Positions (M): 10 Sheep
chromosome 10
46.500 46.500 46.500
SM3 Framework (F): 10 Sheep
chromosome 10
39.200 39.200 39.200
SM3 Framework (M): 10 Sheep
chromosome 10
46.500 46.500 46.500
SM4 Best Positions (A): 10 Sheep
chromosome 10
43.000 43.000 43.000
SM4 Framework (A): 10 Sheep
chromosome 10
42.900 42.900 42.900
SM4 Framework (F): 10 Sheep
chromosome 10
39.800 39.800 39.800
SM4 Framework (M): 10 Sheep
chromosome 10
46.500 46.500 46.500
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
47.500 47.500 47.500
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
45.100 45.100 45.100
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
50.800 50.800 50.800
SM4.2 Framework (A): 10 Sheep
chromosome 10
42.900 42.900 42.900
SM4.2 Framework (F): 10 Sheep
chromosome 10
39.800 39.800 39.800
SM4.2 Framework (M): 10 Sheep
chromosome 10
46.500 46.500 46.500


© The Roslin Institute 2007-2012, all rights reserved