This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011777


Marker Name:  MCMA0010 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GATCTTGTCATCACCAGTTCC
Primer: CCCTAAACTTCTGGGCCTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF139616

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 9 Sheep
chromosome 9
34.600 34.600 34.600
SM3 Best Positions (A): 9 Sheep
chromosome 9
35.000 35.000 35.000
SM3 Best Positions (F): 9 Sheep
chromosome 9
29.300 29.300 29.300
SM3 Best Positions (M): 9 Sheep
chromosome 9
41.600 41.600 41.600
SM3 Framework (F): 9 Sheep
chromosome 9
28.300 28.300 28.300
SM3 Framework (M): 9 Sheep
chromosome 9
42.300 42.300 42.300
SM4 Best Positions (A): 9 Sheep
chromosome 9
35.000 35.000 35.000
SM4 Framework (A): 9 Sheep
chromosome 9
34.600 34.600 34.600
SM4 Framework (F): 9 Sheep
chromosome 9
28.300 28.300 28.300
SM4 Framework (M): 9 Sheep
chromosome 9
42.300 42.300 42.300
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
35.200 35.200 35.200
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
29.300 29.300 29.300
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
42.200 42.200 42.200
SM4.2 Framework (A): 9 Sheep
chromosome 9
34.700 34.700 34.700
SM4.2 Framework (F): 9 Sheep
chromosome 9
28.400 28.400 28.400
SM4.2 Framework (M): 9 Sheep
chromosome 9
42.500 42.500 42.500


© The Roslin Institute 2007-2012, all rights reserved