This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011755


Marker Name:  MCM0357 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ATCTCTTTGCTCACCAATTAAGCA
Primer: CCTGAGAAAACATTGAGTGTGCG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
298.000 298.000 298.000
SM3 Best Positions (A): 1 Sheep
chromosome 1
335.200 335.200 335.200
SM3 Best Positions (F): 1 Sheep
chromosome 1
308.300 308.300 308.300
SM3 Best Positions (M): 1 Sheep
chromosome 1
363.600 363.600 363.600
SM4 Best Positions (A): 1 Sheep
chromosome 1
334.800 334.800 334.800
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
331.600 331.600 331.600
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
301.300 301.300 301.300
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
362.300 362.300 362.300
SMC (A): 1 Sheep
chromosome 1
298.000 298.000 298.000


© The Roslin Institute 2007-2012, all rights reserved