This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011740


Marker Name:  MCM0158 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TTCCTCTGAGTCTCTGACACCGT
Primer: CCGAGATTGAAATGTAAATGAGACA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): X Sheep
chromosome X
0.000 0.000 0.000
SM3 (A): Y Sheep
chromosome Y
0.000 0.000 0.000
SM3 Best Positions (A): X Sheep
chromosome X
0.800 0.800 0.800
SM3 Best Positions (A): Y Sheep
chromosome Y
32.100 32.100 32.100
SM3 Best Positions (F): X Sheep
chromosome X
0.000 0.000 0.000
SM3 Best Positions (M): X Sheep
chromosome X
1.000 1.000 1.000
SM3 Framework (F): X Sheep
chromosome X
0.000 0.000 0.000
SM3 Framework (F): Y Sheep
chromosome Y
0.000 0.000 0.000
SM3 Framework (M): X Sheep
chromosome X
0.000 0.000 0.000
SM3 Framework (M): Y Sheep
chromosome Y
0.000 0.000 0.000
SM4 Best Positions (A): X Sheep
chromosome X
0.800 0.800 0.800
SM4 Framework (A): X Sheep
chromosome X
0.000 0.000 0.000
SM4 Framework (F): X Sheep
chromosome X
0.000 0.000 0.000
SM4 Framework (M): X Sheep
chromosome X
0.000 0.000 0.000
SM4.2 Best Positions (A): X Sheep
chromosome X
0.800 0.800 0.800
SM4.2 Best Positions (F): X Sheep
chromosome X
0.000 0.000 0.000
SM4.2 Best Positions (M): X Sheep
chromosome X
1.000 1.000 1.000
SM4.2 Framework (A): X Sheep
chromosome X
0.000 0.000 0.000
SM4.2 Framework (F): X Sheep
chromosome X
0.000 0.000 0.000
SM4.2 Framework (M): X Sheep
chromosome X
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved