This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011739


Marker Name:  MCM0156 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TTCTTGCCTGGAAGCAGAGG
Primer: CAAAGAAGCCAGGAAAGTATCGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L35311

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 7 Sheep
chromosome 7
125.600 125.600 125.600
SM3 Best Positions (A): 7 Sheep
chromosome 7
133.300 133.300 133.300
SM3 Best Positions (F): 7 Sheep
chromosome 7
136.300 136.300 136.300
SM3 Best Positions (M): 7 Sheep
chromosome 7
133.700 133.700 133.700
SM3 Framework (F): 7 Sheep
chromosome 7
122.300 122.300 122.300
SM3 Framework (M): 7 Sheep
chromosome 7
128.100 128.100 128.100
SM4 Best Positions (A): 7 Sheep
chromosome 7
134.400 134.400 134.400
SM4 Framework (A): 7 Sheep
chromosome 7
124.000 124.000 124.000
SM4 Framework (F): 7 Sheep
chromosome 7
124.300 124.300 124.300
SM4 Framework (M): 7 Sheep
chromosome 7
123.900 123.900 123.900
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
134.400 134.400 134.400
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
135.800 135.800 135.800
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
134.500 134.500 134.500
SM4.2 Framework (A): 7 Sheep
chromosome 7
123.900 123.900 123.900
SM4.2 Framework (F): 7 Sheep
chromosome 7
124.200 124.200 124.200
SM4.2 Framework (M): 7 Sheep
chromosome 7
123.700 123.700 123.700


© The Roslin Institute 2007-2012, all rights reserved