This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011732


Marker Name:  MCM0147 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TCCGATGTTAGATGACTTTTGTGC
Primer: AGCTGGTATCTGTGTCTGTCATCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
39.200 39.200 39.200
SM3 Best Positions (A): 2 Sheep
chromosome 2
39.100 39.100 39.100
SM3 Best Positions (F): 2 Sheep
chromosome 2
35.700 35.700 35.700
SM3 Best Positions (M): 2 Sheep
chromosome 2
42.000 42.000 42.000
SM3 Framework (F): 2 Sheep
chromosome 2
35.800 35.800 35.800
SM3 Framework (M): 2 Sheep
chromosome 2
42.100 42.100 42.100
SM4 Best Positions (A): 2 Sheep
chromosome 2
39.800 39.800 39.800
SM4 Framework (A): 2 Sheep
chromosome 2
39.900 39.900 39.900
SM4 Framework (F): 2 Sheep
chromosome 2
39.300 39.300 39.300
SM4 Framework (M): 2 Sheep
chromosome 2
41.200 41.200 41.200
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
39.800 39.800 39.800
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
38.900 38.900 38.900
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
41.100 41.100 41.100
SM4.2 Framework (A): 2 Sheep
chromosome 2
39.900 39.900 39.900
SM4.2 Framework (F): 2 Sheep
chromosome 2
39.300 39.300 39.300
SM4.2 Framework (M): 2 Sheep
chromosome 2
41.200 41.200 41.200


© The Roslin Institute 2007-2012, all rights reserved