This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011729


Marker Name:  MCM0139 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CTAGGGCTATAGAGGATGGTGTGT
Primer: TCGGACACAACTGAGCATGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L49165

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 7 Sheep
chromosome 7
90.800 90.800 90.800
SM3 Best Positions (A): 7 Sheep
chromosome 7
96.100 96.100 96.100
SM3 Best Positions (F): 7 Sheep
chromosome 7
90.000 90.000 90.000
SM3 Best Positions (M): 7 Sheep
chromosome 7
104.000 104.000 104.000
SM3 Framework (F): 7 Sheep
chromosome 7
82.000 82.000 82.000
SM3 Framework (M): 7 Sheep
chromosome 7
98.100 98.100 98.100
SM4 Best Positions (A): 7 Sheep
chromosome 7
98.700 98.700 98.700
SM4 Framework (A): 7 Sheep
chromosome 7
90.100 90.100 90.100
SM4 Framework (F): 7 Sheep
chromosome 7
84.900 84.900 84.900
SM4 Framework (M): 7 Sheep
chromosome 7
94.700 94.700 94.700
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
98.600 98.600 98.600
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
92.500 92.500 92.500
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
105.200 105.200 105.200
SM4.2 Framework (A): 7 Sheep
chromosome 7
90.000 90.000 90.000
SM4.2 Framework (F): 7 Sheep
chromosome 7
84.900 84.900 84.900
SM4.2 Framework (M): 7 Sheep
chromosome 7
94.500 94.500 94.500


© The Roslin Institute 2007-2012, all rights reserved