This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011727


Marker Name:  MCM0137 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AGGGGAGCCCCAGTAAGTATCA
Primer: AAACAAGTGGGGATGTTAGCTCTT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 1 Sheep
chromosome 1
231.100 231.100 231.100
SM3 Best Positions (A): 1 Sheep
chromosome 1
236.200 236.200 236.200
SM3 Best Positions (F): 1 Sheep
chromosome 1
221.200 221.200 221.200
SM3 Best Positions (M): 1 Sheep
chromosome 1
252.300 252.300 252.300
SM3 Framework (F): 1 Sheep
chromosome 1
215.800 215.800 215.800
SM3 Framework (M): 1 Sheep
chromosome 1
246.400 246.400 246.400
SM4 Best Positions (A): 1 Sheep
chromosome 1
235.800 235.800 235.800
SM4 Framework (A): 1 Sheep
chromosome 1
230.200 230.200 230.200
SM4 Framework (F): 1 Sheep
chromosome 1
214.600 214.600 214.600
SM4 Framework (M): 1 Sheep
chromosome 1
245.700 245.700 245.700
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
232.600 232.600 232.600
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
214.300 214.300 214.300
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
251.200 251.200 251.200
SM4.2 Framework (A): 1 Sheep
chromosome 1
230.200 230.200 230.200
SM4.2 Framework (F): 1 Sheep
chromosome 1
215.300 215.300 215.300
SM4.2 Framework (M): 1 Sheep
chromosome 1
244.900 244.900 244.900


© The Roslin Institute 2007-2012, all rights reserved