This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011719


Marker Name:  MCM0111 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CTGCCTGTCTGTAAAATGGAGCT
Primer: ACTATCCCAGCCTCCTTGAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L35310

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 19 Sheep
chromosome 19
68.500 68.500 68.500
SM3 Best Positions (A): 19 Sheep
chromosome 19
66.800 66.800 66.800
SM3 Best Positions (F): 19 Sheep
chromosome 19
62.200 62.200 62.200
SM3 Best Positions (M): 19 Sheep
chromosome 19
76.600 76.600 76.600
SM3 Framework (F): 19 Sheep
chromosome 19
63.100 63.100 63.100
SM3 Framework (M): 19 Sheep
chromosome 19
77.600 77.600 77.600
SM4 Best Positions (A): 19 Sheep
chromosome 19
67.300 67.300 67.300
SM4 Framework (A): 19 Sheep
chromosome 19
68.500 68.500 68.500
SM4 Framework (F): 19 Sheep
chromosome 19
63.100 63.100 63.100
SM4 Framework (M): 19 Sheep
chromosome 19
77.600 77.600 77.600
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
67.500 67.500 67.500
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
63.700 63.700 63.700
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
75.500 75.500 75.500
SM4.2 Framework (A): 19 Sheep
chromosome 19
68.000 68.000 68.000
SM4.2 Framework (F): 19 Sheep
chromosome 19
64.000 64.000 64.000
SM4.2 Framework (M): 19 Sheep
chromosome 19
75.800 75.800 75.800


© The Roslin Institute 2007-2012, all rights reserved