This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011711


Marker Name:  MCM0064 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TACAGTCCATGGGGTCACAAGAG
Primer: TCTGAATCTACTCCCTCCTCAGAGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 2 Sheep
chromosome 2
9.200 9.200 9.200
SM2 (A): 2 Sheep
chromosome 2
19.200 19.200 19.200
SM3 (A): 2 Sheep
chromosome 2
63.200 63.200 63.200
SM3 Best Positions (A): 2 Sheep
chromosome 2
63.000 63.000 63.000
SM3 Best Positions (F): 2 Sheep
chromosome 2
63.300 63.300 63.300
SM3 Best Positions (M): 2 Sheep
chromosome 2
63.000 63.000 63.000
SM3 Framework (F): 2 Sheep
chromosome 2
64.000 64.000 64.000
SM3 Framework (M): 2 Sheep
chromosome 2
63.300 63.300 63.300
SM4 Best Positions (A): 2 Sheep
chromosome 2
64.600 64.600 64.600
SM4 Framework (A): 2 Sheep
chromosome 2
64.800 64.800 64.800
SM4 Framework (F): 2 Sheep
chromosome 2
68.000 68.000 68.000
SM4 Framework (M): 2 Sheep
chromosome 2
63.100 63.100 63.100
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
64.600 64.600 64.600
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
67.100 67.100 67.100
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
62.900 62.900 62.900
SM4.2 Framework (A): 2 Sheep
chromosome 2
64.800 64.800 64.800
SM4.2 Framework (F): 2 Sheep
chromosome 2
68.000 68.000 68.000
SM4.2 Framework (M): 2 Sheep
chromosome 2
63.100 63.100 63.100
SMC (A): 2 Sheep
chromosome 2
19.200 19.200 19.200


© The Roslin Institute 2007-2012, all rights reserved