This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011710


Marker Name:  MCM0063 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CCCAATTTGGCAACAGCTACG
Primer: ATTGGCCTCTCTCTGATGCAC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 9 Sheep
chromosome 9
91.800 91.800 91.800
SM3 Best Positions (A): 9 Sheep
chromosome 9
92.500 92.500 92.500
SM3 Best Positions (F): 9 Sheep
chromosome 9
83.000 83.000 83.000
SM3 Best Positions (M): 9 Sheep
chromosome 9
100.700 100.700 100.700
SM3 Framework (F): 9 Sheep
chromosome 9
79.400 79.400 79.400
SM3 Framework (M): 9 Sheep
chromosome 9
102.400 102.400 102.400
SM4 Best Positions (A): 9 Sheep
chromosome 9
92.500 92.500 92.500
SM4 Framework (A): 9 Sheep
chromosome 9
91.800 91.800 91.800
SM4 Framework (F): 9 Sheep
chromosome 9
79.500 79.500 79.500
SM4 Framework (M): 9 Sheep
chromosome 9
102.400 102.400 102.400
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
93.100 93.100 93.100
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
82.500 82.500 82.500
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
102.400 102.400 102.400
SM4.2 Framework (A): 9 Sheep
chromosome 9
92.300 92.300 92.300
SM4.2 Framework (F): 9 Sheep
chromosome 9
78.700 78.700 78.700
SM4.2 Framework (M): 9 Sheep
chromosome 9
104.200 104.200 104.200


© The Roslin Institute 2007-2012, all rights reserved