This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011708


Marker Name:  MCM0053 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CATGGAGTTGTAGAGTCAGACATGA
Primer: GAGCAAAGGTCATGTCAGGTGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L37888

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
26.900 26.900 26.900
SM3 Best Positions (A): 6 Sheep
chromosome 6
29.900 29.900 29.900
SM3 Best Positions (F): 6 Sheep
chromosome 6
20.700 20.700 20.700
SM3 Best Positions (M): 6 Sheep
chromosome 6
40.900 40.900 40.900
SM3 Framework (F): 6 Sheep
chromosome 6
19.000 19.000 19.000
SM3 Framework (M): 6 Sheep
chromosome 6
36.000 36.000 36.000
SM4 Best Positions (A): 6 Sheep
chromosome 6
29.700 29.700 29.700
SM4 Framework (A): 6 Sheep
chromosome 6
26.300 26.300 26.300
SM4 Framework (F): 6 Sheep
chromosome 6
18.700 18.700 18.700
SM4 Framework (M): 6 Sheep
chromosome 6
32.600 32.600 32.600
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
29.700 29.700 29.700
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
20.400 20.400 20.400
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
37.800 37.800 37.800
SM4.2 Framework (A): 6 Sheep
chromosome 6
26.300 26.300 26.300
SM4.2 Framework (F): 6 Sheep
chromosome 6
18.700 18.700 18.700
SM4.2 Framework (M): 6 Sheep
chromosome 6
32.600 32.600 32.600


© The Roslin Institute 2007-2012, all rights reserved