This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011688


Marker Name:  MAF0109 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GGAAGATTAGAACTTTCATATATCTTTAAACTC
Primer: TAATTGAATTTGAAGTGTATATGCCTAAATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X59933

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 1 Sheep
chromosome 1
155.700 155.700 155.700
SM2 (A): 1 Sheep
chromosome 1
227.900 227.900 227.900
SM3 (A): 1 Sheep
chromosome 1
261.100 261.100 261.100
SM3 Best Positions (A): 1 Sheep
chromosome 1
266.100 266.100 266.100
SM3 Best Positions (F): 1 Sheep
chromosome 1
247.600 247.600 247.600
SM3 Best Positions (M): 1 Sheep
chromosome 1
284.800 284.800 284.800
SM3 Framework (F): 1 Sheep
chromosome 1
242.500 242.500 242.500
SM3 Framework (M): 1 Sheep
chromosome 1
279.100 279.100 279.100
SM4 Best Positions (A): 1 Sheep
chromosome 1
265.600 265.600 265.600
SM4 Framework (A): 1 Sheep
chromosome 1
260.200 260.200 260.200
SM4 Framework (F): 1 Sheep
chromosome 1
241.300 241.300 241.300
SM4 Framework (M): 1 Sheep
chromosome 1
278.400 278.400 278.400
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
262.400 262.400 262.400
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
240.700 240.700 240.700
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
283.800 283.800 283.800
SM4.2 Framework (A): 1 Sheep
chromosome 1
260.200 260.200 260.200
SM4.2 Framework (F): 1 Sheep
chromosome 1
242.200 242.200 242.200
SM4.2 Framework (M): 1 Sheep
chromosome 1
277.600 277.600 277.600
SMC (A): 1 Sheep
chromosome 1
227.900 227.900 227.900


© The Roslin Institute 2007-2012, all rights reserved