This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011683


Marker Name:  MAF0064 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: AATAGACCATTCAGAGAAACGTTGAC
Primer: CTCATGGAATCAGACAAAAGGTAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M62993

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 1 Sheep
chromosome 1
49.400 49.400 49.400
SM2 (A): 1 Sheep
chromosome 1
127.300 127.300 127.300
SM3 (A): 1 Sheep
chromosome 1
62.700 62.700 62.700
SM3 Best Positions (A): 1 Sheep
chromosome 1
167.800 167.800 167.800
SM3 Best Positions (F): 1 Sheep
chromosome 1
154.200 154.200 154.200
SM3 Best Positions (M): 1 Sheep
chromosome 1
182.500 182.500 182.500
SM3 Framework (F): 1 Sheep
chromosome 1
148.300 148.300 148.300
SM3 Framework (M): 1 Sheep
chromosome 1
176.500 176.500 176.500
SM4 Best Positions (A): 1 Sheep
chromosome 1
167.500 167.500 167.500
SM4 Framework (A): 1 Sheep
chromosome 1
161.800 161.800 161.800
SM4 Framework (F): 1 Sheep
chromosome 1
147.200 147.200 147.200
SM4 Framework (M): 1 Sheep
chromosome 1
175.800 175.800 175.800
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
164.000 164.000 164.000
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
146.000 146.000 146.000
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
182.300 182.300 182.300
SM4.2 Framework (A): 1 Sheep
chromosome 1
161.400 161.400 161.400
SM4.2 Framework (F): 1 Sheep
chromosome 1
147.100 147.100 147.100
SM4.2 Framework (M): 1 Sheep
chromosome 1
175.600 175.600 175.600
SMC (A): 1 Sheep
chromosome 1
127.300 127.300 127.300


© The Roslin Institute 2007-2012, all rights reserved