This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011678


Marker Name:  MAF0036 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TTGCGAAAAGTTGGACACAATTGAGC
Primer: CATATACCTGGGAGGAATGCATTACG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M80519

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 22 Sheep
chromosome 22
42.300 42.300 42.300
SM2 (A): 22 Sheep
chromosome 22
72.800 72.800 72.800
SM3 (A): 22 Sheep
chromosome 22
79.800 79.800 79.800
SM3 Best Positions (A): 22 Sheep
chromosome 22
77.900 77.900 77.900
SM3 Best Positions (F): 22 Sheep
chromosome 22
61.700 61.700 61.700
SM3 Best Positions (M): 22 Sheep
chromosome 22
88.200 88.200 88.200
SM3 Framework (F): 22 Sheep
chromosome 22
64.900 64.900 64.900
SM3 Framework (M): 22 Sheep
chromosome 22
91.200 91.200 91.200
SM4 Best Positions (A): 22 Sheep
chromosome 22
76.900 76.900 76.900
SM4 Framework (A): 22 Sheep
chromosome 22
78.800 78.800 78.800
SM4 Framework (F): 22 Sheep
chromosome 22
62.700 62.700 62.700
SM4 Framework (M): 22 Sheep
chromosome 22
91.300 91.300 91.300
SM4.2 Best Positions (A): 22 Sheep
chromosome 22
77.200 77.200 77.200
SM4.2 Best Positions (F): 22 Sheep
chromosome 22
59.600 59.600 59.600
SM4.2 Best Positions (M): 22 Sheep
chromosome 22
88.200 88.200 88.200
SM4.2 Framework (A): 22 Sheep
chromosome 22
77.400 77.400 77.400
SM4.2 Framework (F): 22 Sheep
chromosome 22
59.700 59.700 59.700
SM4.2 Framework (M): 22 Sheep
chromosome 22
88.200 88.200 88.200
SMC (A): 22 Sheep
chromosome 22
72.800 72.800 72.800


© The Roslin Institute 2007-2012, all rights reserved