This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011669


Marker Name:  LSCV0105 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GATAAGTTATGAGCCTTACCG
Primer: CCAGATTCTCCAGATACATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G41205

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 1 Sheep
chromosome 1
263.900 263.900 263.900
SM3 Best Positions (A): 1 Sheep
chromosome 1
268.800 268.800 268.800
SM3 Best Positions (F): 1 Sheep
chromosome 1
251.400 251.400 251.400
SM3 Best Positions (M): 1 Sheep
chromosome 1
286.700 286.700 286.700
SM3 Framework (F): 1 Sheep
chromosome 1
246.400 246.400 246.400
SM3 Framework (M): 1 Sheep
chromosome 1
281.000 281.000 281.000
SM4 Best Positions (A): 1 Sheep
chromosome 1
268.300 268.300 268.300
SM4 Framework (A): 1 Sheep
chromosome 1
262.900 262.900 262.900
SM4 Framework (F): 1 Sheep
chromosome 1
245.100 245.100 245.100
SM4 Framework (M): 1 Sheep
chromosome 1
280.300 280.300 280.300
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
265.100 265.100 265.100
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
244.500 244.500 244.500
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
285.700 285.700 285.700
SM4.2 Framework (A): 1 Sheep
chromosome 1
262.900 262.900 262.900
SM4.2 Framework (F): 1 Sheep
chromosome 1
245.900 245.900 245.900
SM4.2 Framework (M): 1 Sheep
chromosome 1
279.500 279.500 279.500


© The Roslin Institute 2007-2012, all rights reserved