This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011668


Marker Name:  LSCV0086 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: CAGAAACATGACTTAGAACGT
Primer: TCCAAGTGTTTAGAAGATCAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G54277
has an Associated Sequence: Sequence Genbank ID: AF404302

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 1 Sheep
chromosome 1
295.300 295.300 295.300
SM4 Framework (A): 1 Sheep
chromosome 1
290.100 290.100 290.100
SM4 Framework (F): 1 Sheep
chromosome 1
269.100 269.100 269.100
SM4 Framework (M): 1 Sheep
chromosome 1
309.500 309.500 309.500
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
292.100 292.100 292.100
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
268.300 268.300 268.300
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
316.500 316.500 316.500
SM4.2 Framework (A): 1 Sheep
chromosome 1
290.100 290.100 290.100
SM4.2 Framework (F): 1 Sheep
chromosome 1
269.900 269.900 269.900
SM4.2 Framework (M): 1 Sheep
chromosome 1
308.800 308.800 308.800


© The Roslin Institute 2007-2012, all rights reserved