This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011664


Marker Name:  LSCV0043 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CCAGAATATAGAGTTTTGTCAAG
Primer: GCCTGATTTGTATTTGTATGAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
44.900 44.900 44.900
SM3 Best Positions (A): 6 Sheep
chromosome 6
49.100 49.100 49.100
SM3 Best Positions (F): 6 Sheep
chromosome 6
37.900 37.900 37.900
SM3 Best Positions (M): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM3 Framework (F): 6 Sheep
chromosome 6
34.100 34.100 34.100
SM3 Framework (M): 6 Sheep
chromosome 6
54.700 54.700 54.700
SM4 Best Positions (A): 6 Sheep
chromosome 6
48.000 48.000 48.000
SM4 Framework (A): 6 Sheep
chromosome 6
43.800 43.800 43.800
SM4 Framework (F): 6 Sheep
chromosome 6
33.900 33.900 33.900
SM4 Framework (M): 6 Sheep
chromosome 6
52.200 52.200 52.200
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
47.800 47.800 47.800
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
38.700 38.700 38.700
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
56.600 56.600 56.600
SM4.2 Framework (A): 6 Sheep
chromosome 6
43.800 43.800 43.800
SM4.2 Framework (F): 6 Sheep
chromosome 6
33.900 33.900 33.900
SM4.2 Framework (M): 6 Sheep
chromosome 6
52.200 52.200 52.200
SMC (A): 6 Sheep
chromosome 6
50.000 50.000 50.000


© The Roslin Institute 2007-2012, all rights reserved