This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011610


Marker Name:  KRTAP7 
Species:  Sheep
Marker Type:  PCR-RFLP
Publication ID: 11435411

PCR Primers

Primer: CATCGGACAGCTTGAGGTAT
Primer: ACAGAGAATTGAGGGCGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 1 Sheep
chromosome 1
155.000 155.000 155.000
SM4 Best Positions (A): 1 Sheep
chromosome 1
154.700 154.700 154.700
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
151.200 151.200 151.200
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
135.600 135.600 135.600
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
167.800 167.800 167.800
SMC (A): 1 Sheep
chromosome 1
114.000 114.000 114.000


© The Roslin Institute 2007-2012, all rights reserved