This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011585


Marker Name:  KD0721 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GTCACAAGACCTCTTCCAGCCAAAGT
Primer: AAACAAGTACCCCACAGTGCCT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 1 Sheep
chromosome 1
305.200 305.200 305.200
SM3 Best Positions (A): 1 Sheep
chromosome 1
310.900 310.900 310.900
SM3 Best Positions (F): 1 Sheep
chromosome 1
288.100 288.100 288.100
SM3 Best Positions (M): 1 Sheep
chromosome 1
337.000 337.000 337.000
SM3 Framework (F): 1 Sheep
chromosome 1
283.400 283.400 283.400
SM3 Framework (M): 1 Sheep
chromosome 1
328.600 328.600 328.600
SM4 Best Positions (A): 1 Sheep
chromosome 1
311.000 311.000 311.000
SM4 Framework (A): 1 Sheep
chromosome 1
305.100 305.100 305.100
SM4 Framework (F): 1 Sheep
chromosome 1
281.700 281.700 281.700
SM4 Framework (M): 1 Sheep
chromosome 1
327.900 327.900 327.900
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
307.800 307.800 307.800
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
281.200 281.200 281.200
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
336.500 336.500 336.500
SM4.2 Framework (A): 1 Sheep
chromosome 1
305.000 305.000 305.000
SM4.2 Framework (F): 1 Sheep
chromosome 1
282.500 282.500 282.500
SM4.2 Framework (M): 1 Sheep
chromosome 1
327.200 327.200 327.200


© The Roslin Institute 2007-2012, all rights reserved