This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011553


Marker Name:  INRA0136 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGGCCTAAATATTTATCAGTG
Primer: GAGACCTTTCCTCTTTCTCAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X73129

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 9 Sheep
chromosome 9
15.900 15.900 15.900
SM3 Best Positions (A): 9 Sheep
chromosome 9
15.700 15.700 15.700
SM3 Best Positions (F): 9 Sheep
chromosome 9
15.600 15.600 15.600
SM3 Best Positions (M): 9 Sheep
chromosome 9
15.300 15.300 15.300
SM3 Framework (F): 9 Sheep
chromosome 9
15.600 15.600 15.600
SM3 Framework (M): 9 Sheep
chromosome 9
15.500 15.500 15.500
SM4 Best Positions (A): 9 Sheep
chromosome 9
15.700 15.700 15.700
SM4 Framework (A): 9 Sheep
chromosome 9
15.900 15.900 15.900
SM4 Framework (F): 9 Sheep
chromosome 9
15.600 15.600 15.600
SM4 Framework (M): 9 Sheep
chromosome 9
15.500 15.500 15.500
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
15.700 15.700 15.700
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
15.600 15.600 15.600
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
15.300 15.300 15.300
SM4.2 Framework (A): 9 Sheep
chromosome 9
15.900 15.900 15.900
SM4.2 Framework (F): 9 Sheep
chromosome 9
15.600 15.600 15.600
SM4.2 Framework (M): 9 Sheep
chromosome 9
15.500 15.500 15.500


© The Roslin Institute 2007-2012, all rights reserved