This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011551


Marker Name:  INRA0133 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ATCCTCAAAGCAACCTGGC
Primer: GAATCTTCTCCCCCTGCATC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X73127

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 6 Sheep
chromosome 6
1.200 1.200 1.200
SM3 Best Positions (A): 6 Sheep
chromosome 6
13.700 13.700 13.700
SM3 Best Positions (F): 6 Sheep
chromosome 6
5.400 5.400 5.400
SM3 Best Positions (M): 6 Sheep
chromosome 6
23.200 23.200 23.200
SM4 Best Positions (A): 6 Sheep
chromosome 6
16.000 16.000 16.000
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
16.000 16.000 16.000
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
6.400 6.400 6.400
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
20.800 20.800 20.800
SMC (A): 6 Sheep
chromosome 6
7.900 7.900 7.900


© The Roslin Institute 2007-2012, all rights reserved