This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011529


Marker Name:  INRA0088 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CATTCCTTTGATGTAGGAG
Primer: CTGTCACAAAGAGATACAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X71566

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 1 Sheep
chromosome 1
49.700 49.700 49.700
SM3 Best Positions (F): 1 Sheep
chromosome 1
44.400 44.400 44.400
SM3 Best Positions (M): 1 Sheep
chromosome 1
56.500 56.500 56.500
SM4 Best Positions (A): 1 Sheep
chromosome 1
49.700 49.700 49.700
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
46.100 46.100 46.100
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
36.400 36.400 36.400
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
56.500 56.500 56.500


© The Roslin Institute 2007-2012, all rights reserved