This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011513


Marker Name:  INRA0035 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ATCCTTTGCAGCCTCCACATTG
Primer: TTGTGCTTTATGACACTATCCG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X68049

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 12 Sheep
chromosome 12
98.400 98.400 98.400
SM3 (A): 12 Sheep
chromosome 12
87.000 87.000 87.000
SM3 Best Positions (A): 12 Sheep
chromosome 12
87.600 87.600 87.600
SM3 Best Positions (F): 12 Sheep
chromosome 12
82.500 82.500 82.500
SM3 Best Positions (M): 12 Sheep
chromosome 12
91.700 91.700 91.700
SM3 Framework (F): 12 Sheep
chromosome 12
78.300 78.300 78.300
SM3 Framework (M): 12 Sheep
chromosome 12
93.800 93.800 93.800
SM4 Best Positions (A): 12 Sheep
chromosome 12
92.600 92.600 92.600
SM4 Framework (A): 12 Sheep
chromosome 12
92.700 92.700 92.700
SM4 Framework (F): 12 Sheep
chromosome 12
80.000 80.000 80.000
SM4 Framework (M): 12 Sheep
chromosome 12
103.700 103.700 103.700
SM4.2 Best Positions (A): 12 Sheep
chromosome 12
92.100 92.100 92.100
SM4.2 Best Positions (F): 12 Sheep
chromosome 12
83.000 83.000 83.000
SM4.2 Best Positions (M): 12 Sheep
chromosome 12
101.600 101.600 101.600
SM4.2 Framework (A): 12 Sheep
chromosome 12
92.500 92.500 92.500
SM4.2 Framework (F): 12 Sheep
chromosome 12
79.900 79.900 79.900
SM4.2 Framework (M): 12 Sheep
chromosome 12
103.300 103.300 103.300
SMC (A): 12 Sheep
chromosome 12
98.400 98.400 98.400


© The Roslin Institute 2007-2012, all rights reserved