This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011476


Marker Name:  ILSTS0087 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGCAGACATGATGACTCAGC
Primer: CTGCCTCTTTTCTTGAGAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L37279

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 6 Sheep
chromosome 6
96.000 96.000 96.000
SM3 Best Positions (A): 6 Sheep
chromosome 6
101.900 101.900 101.900
SM3 Best Positions (F): 6 Sheep
chromosome 6
81.400 81.400 81.400
SM3 Best Positions (M): 6 Sheep
chromosome 6
121.400 121.400 121.400
SM4 Best Positions (A): 6 Sheep
chromosome 6
100.600 100.600 100.600
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
100.600 100.600 100.600
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
81.200 81.200 81.200
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
118.600 118.600 118.600
SMC (A): 6 Sheep
chromosome 6
102.000 102.000 102.000


© The Roslin Institute 2007-2012, all rights reserved