This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011428


Marker Name:  ILSTS0030 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CTGCAGTTCTGCATATGTGG
Primer: CTTAGACAACAGGGGTTTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L37212

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
142.700 142.700 142.700
SM3 (A): 2 Sheep
chromosome 2
178.700 178.700 178.700
SM3 Best Positions (A): 2 Sheep
chromosome 2
177.200 177.200 177.200
SM3 Best Positions (F): 2 Sheep
chromosome 2
171.700 171.700 171.700
SM3 Best Positions (M): 2 Sheep
chromosome 2
179.200 179.200 179.200
SM3 Framework (F): 2 Sheep
chromosome 2
174.000 174.000 174.000
SM3 Framework (M): 2 Sheep
chromosome 2
180.500 180.500 180.500
SM4 Best Positions (A): 2 Sheep
chromosome 2
179.700 179.700 179.700
SM4 Framework (A): 2 Sheep
chromosome 2
181.300 181.300 181.300
SM4 Framework (F): 2 Sheep
chromosome 2
180.000 180.000 180.000
SM4 Framework (M): 2 Sheep
chromosome 2
180.100 180.100 180.100
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
180.500 180.500 180.500
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
177.200 177.200 177.200
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
181.400 181.400 181.400
SM4.2 Framework (A): 2 Sheep
chromosome 2
182.000 182.000 182.000
SM4.2 Framework (F): 2 Sheep
chromosome 2
179.700 179.700 179.700
SM4.2 Framework (M): 2 Sheep
chromosome 2
182.100 182.100 182.100
SMC (A): 2 Sheep
chromosome 2
142.700 142.700 142.700


© The Roslin Institute 2007-2012, all rights reserved