This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011326


Marker Name:  HEL0014 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CCAACCAGGGTTTGAACTGA
Primer: TGGTTATGTGTTATGTGGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X65209

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (F): X Sheep
chromosome X
106.200 106.200 106.200
SM3 (A): X Sheep
chromosome X
39.700 39.700 39.700
SM3 Best Positions (A): X Sheep
chromosome X
41.800 41.800 41.800
SM3 Best Positions (F): X Sheep
chromosome X
24.000 24.000 24.000
SM3 Framework (F): X Sheep
chromosome X
22.300 22.300 22.300
SM4 Best Positions (A): X Sheep
chromosome X
41.800 41.800 41.800
SM4.2 Best Positions (A): X Sheep
chromosome X
41.600 41.600 41.600
SM4.2 Best Positions (F): X Sheep
chromosome X
23.500 23.500 23.500
SMC (F): X Sheep
chromosome X
24.000 24.000 24.000


© The Roslin Institute 2007-2012, all rights reserved