This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011305


Marker Name:  GNRHR 
Species:  Sheep
Marker Type:  RFLP
Publication ID: 11435411

PCR Primers

Primer: AGCAACCAACCCACTATCCACTC
Primer: GAATGTTCTATCCCCCAGTTCAAAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X72088

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 6 Sheep
chromosome 6
101.400 101.400 101.400
SM3 Best Positions (F): 6 Sheep
chromosome 6
81.400 81.400 81.400
SM3 Best Positions (M): 6 Sheep
chromosome 6
120.500 120.500 120.500
SM4 Best Positions (A): 6 Sheep
chromosome 6
100.100 100.100 100.100
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
100.100 100.100 100.100
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
81.200 81.200 81.200
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
117.700 117.700 117.700
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
100.100 100.100 100.100
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
81.200 81.200 81.200
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
117.700 117.700 117.700
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
100.100 100.100 100.100
SMC (A): 6 Sheep
chromosome 6
102.000 102.000 102.000


© The Roslin Institute 2007-2012, all rights reserved