This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011272


Marker Name:  FGFR3 
Species:  Sheep
Marker Type:  SSCP
Publication ID: not available  

PCR Primers

Primer: CCTGTACGTGCTGGTGGAGTA
Primer: AGCTGCTTGAAGGTGGGCCTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M58051

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SMC (A): 6 Sheep
chromosome 6
144.700 144.700 144.700


© The Roslin Institute 2007-2012, all rights reserved