This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011244


Marker Name:  EPCDV0022 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CTGGGATGAGAGAGTTCTTAG
Primer: GCTCACGACTGAATGACTGA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 1 Sheep
chromosome 1
26.600 26.600 26.600
SM3 Best Positions (F): 1 Sheep
chromosome 1
22.500 22.500 22.500
SM3 Best Positions (M): 1 Sheep
chromosome 1
32.700 32.700 32.700
SM4 Best Positions (A): 1 Sheep
chromosome 1
26.600 26.600 26.600
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
26.400 26.400 26.400
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
22.400 22.400 22.400
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
32.700 32.700 32.700
SM4.2 Framework (A): 1 Sheep
chromosome 1
24.300 24.300 24.300
SM4.2 Framework (F): 1 Sheep
chromosome 1
19.700 19.700 19.700
SM4.2 Framework (M): 1 Sheep
chromosome 1
30.900 30.900 30.900


© The Roslin Institute 2007-2012, all rights reserved