This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011240


Marker Name:  EPCDV0020 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GTGTTTACCATTTAGAAATTCC
Primer: GCCACAGATGACAGGATTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 7 Sheep
chromosome 7
116.500 116.500 116.500
SM3 Best Positions (A): 7 Sheep
chromosome 7
121.500 121.500 121.500
SM3 Best Positions (F): 7 Sheep
chromosome 7
120.100 120.100 120.100
SM3 Best Positions (M): 7 Sheep
chromosome 7
125.500 125.500 125.500
SM3 Framework (F): 7 Sheep
chromosome 7
112.200 112.200 112.200
SM3 Framework (M): 7 Sheep
chromosome 7
120.300 120.300 120.300
SM4 Best Positions (A): 7 Sheep
chromosome 7
123.900 123.900 123.900
SM4 Framework (A): 7 Sheep
chromosome 7
115.500 115.500 115.500
SM4 Framework (F): 7 Sheep
chromosome 7
113.900 113.900 113.900
SM4 Framework (M): 7 Sheep
chromosome 7
117.000 117.000 117.000
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
123.900 123.900 123.900
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
121.300 121.300 121.300
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
127.200 127.200 127.200
SM4.2 Framework (A): 7 Sheep
chromosome 7
115.400 115.400 115.400
SM4.2 Framework (F): 7 Sheep
chromosome 7
113.900 113.900 113.900
SM4.2 Framework (M): 7 Sheep
chromosome 7
116.800 116.800 116.800


© The Roslin Institute 2007-2012, all rights reserved