This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011204


Marker Name:  EPCDV0001 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GGCCTTATGGAAGATTTATGCT
Primer: GTTGCCTCTCAAAGTGCCTC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 1 Sheep
chromosome 1
322.900 322.900 322.900
SM3 Best Positions (A): 1 Sheep
chromosome 1
328.100 328.100 328.100
SM3 Best Positions (F): 1 Sheep
chromosome 1
307.300 307.300 307.300
SM3 Best Positions (M): 1 Sheep
chromosome 1
349.900 349.900 349.900
SM3 Framework (F): 1 Sheep
chromosome 1
303.500 303.500 303.500
SM3 Framework (M): 1 Sheep
chromosome 1
342.100 342.100 342.100
SM4 Best Positions (A): 1 Sheep
chromosome 1
327.700 327.700 327.700
SM4 Framework (A): 1 Sheep
chromosome 1
322.100 322.100 322.100
SM4 Framework (F): 1 Sheep
chromosome 1
302.200 302.200 302.200
SM4 Framework (M): 1 Sheep
chromosome 1
339.400 339.400 339.400
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
324.500 324.500 324.500
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
301.300 301.300 301.300
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
347.600 347.600 347.600
SM4.2 Framework (A): 1 Sheep
chromosome 1
322.100 322.100 322.100
SM4.2 Framework (F): 1 Sheep
chromosome 1
303.000 303.000 303.000
SM4.2 Framework (M): 1 Sheep
chromosome 1
338.600 338.600 338.600


© The Roslin Institute 2007-2012, all rights reserved