This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011202


Marker Name:  EPB49 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: GTTCCTGCCCAGACCCTGAGAT
Primer: TGCAACCTTTTAATTCCAAGCAGAGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BF601350

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 2 Sheep
chromosome 2
62.400 62.400 62.400
SM4 Framework (A): 2 Sheep
chromosome 2
62.700 62.700 62.700
SM4 Framework (F): 2 Sheep
chromosome 2
66.500 66.500 66.500
SM4 Framework (M): 2 Sheep
chromosome 2
60.400 60.400 60.400
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
62.400 62.400 62.400
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
65.700 65.700 65.700
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
60.100 60.100 60.100
SM4.2 Framework (A): 2 Sheep
chromosome 2
62.700 62.700 62.700
SM4.2 Framework (F): 2 Sheep
chromosome 2
66.500 66.500 66.500
SM4.2 Framework (M): 2 Sheep
chromosome 2
60.400 60.400 60.400
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
61.700 61.700 61.700
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
64.600 64.600 64.600
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
60.000 60.000 60.000
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
61.700 61.700 61.700


© The Roslin Institute 2007-2012, all rights reserved