This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011195


Marker Name:  EGF 
Species:  Sheep
Marker Type:  RFLP
Publication ID: 7498748

PCR Primers

Primer: GAATCATTACAGTAACTGATATG
Primer: ACCTCTGAAGACCAAAACACAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U36428

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
0.100 0.100 0.100
SM2 (A): 6 Sheep
chromosome 6
15.000 15.000 15.000
SM3 (A): 6 Sheep
chromosome 6
22.800 22.800 22.800
SM3 Best Positions (A): 6 Sheep
chromosome 6
25.800 25.800 25.800
SM3 Best Positions (F): 6 Sheep
chromosome 6
16.800 16.800 16.800
SM3 Best Positions (M): 6 Sheep
chromosome 6
35.900 35.900 35.900
SM3 Framework (F): 6 Sheep
chromosome 6
15.500 15.500 15.500
SM3 Framework (M): 6 Sheep
chromosome 6
31.200 31.200 31.200
SM4 Best Positions (A): 6 Sheep
chromosome 6
25.800 25.800 25.800
SM4 Framework (A): 6 Sheep
chromosome 6
22.400 22.400 22.400
SM4 Framework (F): 6 Sheep
chromosome 6
15.200 15.200 15.200
SM4 Framework (M): 6 Sheep
chromosome 6
27.100 27.100 27.100
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
25.800 25.800 25.800
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
16.600 16.600 16.600
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
32.000 32.000 32.000
SM4.2 Framework (A): 6 Sheep
chromosome 6
22.400 22.400 22.400
SM4.2 Framework (F): 6 Sheep
chromosome 6
15.200 15.200 15.200
SM4.2 Framework (M): 6 Sheep
chromosome 6
27.100 27.100 27.100
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
25.800 25.800 25.800
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
16.600 16.600 16.600
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
32.000 32.000 32.000
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
25.800 25.800 25.800
SMC (A): 6 Sheep
chromosome 6
21.700 21.700 21.700


© The Roslin Institute 2007-2012, all rights reserved