This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011169


Marker Name:  CYP19A1 
Species:  Sheep
Marker Type:  PCR-RFLP
Publication ID: not available  

PCR Primers

Primer: CCAGCTACTTTCTGGGAATT
Primer: AATAAGGGTTTCCTCTCCACA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 7 Sheep
chromosome 7
82.000 82.000 82.000
SM4 Framework (A): 7 Sheep
chromosome 7
81.200 81.200 81.200
SM4 Framework (F): 7 Sheep
chromosome 7
75.900 75.900 75.900
SM4 Framework (M): 7 Sheep
chromosome 7
86.000 86.000 86.000
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
82.000 82.000 82.000
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
79.600 79.600 79.600
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
85.200 85.200 85.200
SM4.2 Framework (A): 7 Sheep
chromosome 7
81.100 81.100 81.100
SM4.2 Framework (F): 7 Sheep
chromosome 7
75.900 75.900 75.900
SM4.2 Framework (M): 7 Sheep
chromosome 7
85.300 85.300 85.300


© The Roslin Institute 2007-2012, all rights reserved