This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011150


Marker Name:  CSSM0051 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AGGGGAAAGAAAGCTAAGCTGCTA
Primer: ACTGTATGAGCCACCAGGGAAGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U03826

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 10 Sheep
chromosome 10
38.900 38.900 38.900
SM3 Best Positions (A): 10 Sheep
chromosome 10
38.800 38.800 38.800
SM3 Best Positions (F): 10 Sheep
chromosome 10
35.400 35.400 35.400
SM3 Best Positions (M): 10 Sheep
chromosome 10
42.700 42.700 42.700
SM3 Framework (F): 10 Sheep
chromosome 10
35.400 35.400 35.400
SM3 Framework (M): 10 Sheep
chromosome 10
42.800 42.800 42.800
SM4 Best Positions (A): 10 Sheep
chromosome 10
39.200 39.200 39.200
SM4 Framework (A): 10 Sheep
chromosome 10
38.900 38.900 38.900
SM4 Framework (F): 10 Sheep
chromosome 10
35.400 35.400 35.400
SM4 Framework (M): 10 Sheep
chromosome 10
42.800 42.800 42.800
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
43.700 43.700 43.700
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
41.000 41.000 41.000
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
47.200 47.200 47.200
SM4.2 Framework (A): 10 Sheep
chromosome 10
38.900 38.900 38.900
SM4.2 Framework (F): 10 Sheep
chromosome 10
35.400 35.400 35.400
SM4.2 Framework (M): 10 Sheep
chromosome 10
42.800 42.800 42.800


© The Roslin Institute 2007-2012, all rights reserved