This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011146


Marker Name:  CSSM0045 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TAGAGGCACAAGCAAACCTAACAC
Primer: TTGGAAAGATGCAGTAGAACTCAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U03830

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
217.300 217.300 217.300
SM3 Best Positions (A): 2 Sheep
chromosome 2
216.400 216.400 216.400
SM3 Best Positions (F): 2 Sheep
chromosome 2
204.700 204.700 204.700
SM3 Best Positions (M): 2 Sheep
chromosome 2
223.900 223.900 223.900
SM3 Framework (F): 2 Sheep
chromosome 2
206.800 206.800 206.800
SM3 Framework (M): 2 Sheep
chromosome 2
225.500 225.500 225.500
SM4 Best Positions (A): 2 Sheep
chromosome 2
218.700 218.700 218.700
SM4 Framework (A): 2 Sheep
chromosome 2
219.900 219.900 219.900
SM4 Framework (F): 2 Sheep
chromosome 2
212.900 212.900 212.900
SM4 Framework (M): 2 Sheep
chromosome 2
225.200 225.200 225.200
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
219.500 219.500 219.500
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
213.200 213.200 213.200
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
225.700 225.700 225.700
SM4.2 Framework (A): 2 Sheep
chromosome 2
220.600 220.600 220.600
SM4.2 Framework (F): 2 Sheep
chromosome 2
212.600 212.600 212.600
SM4.2 Framework (M): 2 Sheep
chromosome 2
227.200 227.200 227.200


© The Roslin Institute 2007-2012, all rights reserved