This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011123


Marker Name:  CSSM0006 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AGCTTCTGACCTTTAAAGAAAATG
Primer: AGCTTATAGATTTGCACAAGTGCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U03787

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 19 Sheep
chromosome 19
16.900 16.900 16.900
SM3 Best Positions (A): 19 Sheep
chromosome 19
16.900 16.900 16.900
SM3 Best Positions (F): 19 Sheep
chromosome 19
12.800 12.800 12.800
SM3 Best Positions (M): 19 Sheep
chromosome 19
24.800 24.800 24.800
SM3 Framework (F): 19 Sheep
chromosome 19
12.800 12.800 12.800
SM3 Framework (M): 19 Sheep
chromosome 19
24.800 24.800 24.800
SM4 Best Positions (A): 19 Sheep
chromosome 19
17.400 17.400 17.400
SM4 Framework (A): 19 Sheep
chromosome 19
17.000 17.000 17.000
SM4 Framework (F): 19 Sheep
chromosome 19
12.800 12.800 12.800
SM4 Framework (M): 19 Sheep
chromosome 19
24.900 24.900 24.900
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
17.400 17.400 17.400
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
12.700 12.700 12.700
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
24.700 24.700 24.700
SM4.2 Framework (A): 19 Sheep
chromosome 19
17.000 17.000 17.000
SM4.2 Framework (F): 19 Sheep
chromosome 19
12.800 12.800 12.800
SM4.2 Framework (M): 19 Sheep
chromosome 19
24.900 24.900 24.900


© The Roslin Institute 2007-2012, all rights reserved