This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011119


Marker Name:  CSRD2171 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CATGGAGTCGCAAAGAGTTGGACA
Primer: TGTTGCCACTTCTTCATTTCCTGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
243.900 243.900 243.900
SM3 Best Positions (A): 2 Sheep
chromosome 2
243.300 243.300 243.300
SM3 Best Positions (F): 2 Sheep
chromosome 2
232.700 232.700 232.700
SM3 Best Positions (M): 2 Sheep
chromosome 2
252.500 252.500 252.500
SM3 Framework (F): 2 Sheep
chromosome 2
236.000 236.000 236.000
SM3 Framework (M): 2 Sheep
chromosome 2
253.000 253.000 253.000
SM4 Best Positions (A): 2 Sheep
chromosome 2
247.400 247.400 247.400
SM4 Framework (A): 2 Sheep
chromosome 2
246.600 246.600 246.600
SM4 Framework (F): 2 Sheep
chromosome 2
242.100 242.100 242.100
SM4 Framework (M): 2 Sheep
chromosome 2
252.700 252.700 252.700
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
248.300 248.300 248.300
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
242.200 242.200 242.200
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
254.400 254.400 254.400
SM4.2 Framework (A): 2 Sheep
chromosome 2
247.200 247.200 247.200
SM4.2 Framework (F): 2 Sheep
chromosome 2
241.700 241.700 241.700
SM4.2 Framework (M): 2 Sheep
chromosome 2
254.700 254.700 254.700


© The Roslin Institute 2007-2012, all rights reserved