This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011118


Marker Name:  CSRD2164 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TCTATGTTGTTCAGAATGGTAGGG
Primer: GAACCCTAAGCATCAATCAATGGA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
51.700 51.700 51.700
SM3 Best Positions (A): 2 Sheep
chromosome 2
52.600 52.600 52.600
SM3 Best Positions (F): 2 Sheep
chromosome 2
56.200 56.200 56.200
SM3 Best Positions (M): 2 Sheep
chromosome 2
49.800 49.800 49.800
SM3 Framework (F): 2 Sheep
chromosome 2
56.600 56.600 56.600
SM3 Framework (M): 2 Sheep
chromosome 2
47.700 47.700 47.700
SM4 Best Positions (A): 2 Sheep
chromosome 2
53.000 53.000 53.000
SM4 Framework (A): 2 Sheep
chromosome 2
52.100 52.100 52.100
SM4 Framework (F): 2 Sheep
chromosome 2
58.400 58.400 58.400
SM4 Framework (M): 2 Sheep
chromosome 2
47.100 47.100 47.100
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
53.000 53.000 53.000
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
57.900 57.900 57.900
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
49.200 49.200 49.200
SM4.2 Framework (A): 2 Sheep
chromosome 2
52.100 52.100 52.100
SM4.2 Framework (F): 2 Sheep
chromosome 2
58.400 58.400 58.400
SM4.2 Framework (M): 2 Sheep
chromosome 2
47.100 47.100 47.100


© The Roslin Institute 2007-2012, all rights reserved