This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011116


Marker Name:  CSRD2158 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TACTCAGTCTTTGAGTTAGCTTGG
Primer: GGGAAGCCTCAGGTAGTACTTACA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 6 Sheep
chromosome 6
124.200 124.200 124.200
SM3 Best Positions (F): 6 Sheep
chromosome 6
106.200 106.200 106.200
SM3 Best Positions (M): 6 Sheep
chromosome 6
141.300 141.300 141.300
SM4 Best Positions (A): 6 Sheep
chromosome 6
122.800 122.800 122.800
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
122.700 122.700 122.700
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
105.800 105.800 105.800
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
138.500 138.500 138.500


© The Roslin Institute 2007-2012, all rights reserved