This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011100


Marker Name:  CSRD0287 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ACAAAGGGCATGACTGAGCAACTA
Primer: GGAGAGGATTCAAGTGCATCAGTA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 10 Sheep
chromosome 10
51.700 51.700 51.700
SM3 Best Positions (A): 10 Sheep
chromosome 10
51.500 51.500 51.500
SM3 Best Positions (F): 10 Sheep
chromosome 10
51.500 51.500 51.500
SM3 Best Positions (M): 10 Sheep
chromosome 10
52.300 52.300 52.300
SM3 Framework (F): 10 Sheep
chromosome 10
51.500 51.500 51.500
SM3 Framework (M): 10 Sheep
chromosome 10
52.400 52.400 52.400
SM4 Best Positions (A): 10 Sheep
chromosome 10
51.700 51.700 51.700
SM4 Framework (A): 10 Sheep
chromosome 10
51.300 51.300 51.300
SM4 Framework (F): 10 Sheep
chromosome 10
51.900 51.900 51.900
SM4 Framework (M): 10 Sheep
chromosome 10
52.500 52.500 52.500
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
56.200 56.200 56.200
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
57.700 57.700 57.700
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
56.800 56.800 56.800
SM4.2 Framework (A): 10 Sheep
chromosome 10
51.300 51.300 51.300
SM4.2 Framework (F): 10 Sheep
chromosome 10
51.900 51.900 51.900
SM4.2 Framework (M): 10 Sheep
chromosome 10
52.500 52.500 52.500


© The Roslin Institute 2007-2012, all rights reserved