This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011087


Marker Name:  CSRD0265 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TAGAGAAGGTGGCTGATGTCAGAG
Primer: AAACAGCAGTTGCTTGGGTGTACG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
14.300 14.300 14.300
SM3 Best Positions (A): 2 Sheep
chromosome 2
14.200 14.200 14.200
SM3 Best Positions (F): 2 Sheep
chromosome 2
5.800 5.800 5.800
SM3 Best Positions (M): 2 Sheep
chromosome 2
20.400 20.400 20.400
SM3 Framework (F): 2 Sheep
chromosome 2
5.500 5.500 5.500
SM3 Framework (M): 2 Sheep
chromosome 2
20.700 20.700 20.700
SM4 Best Positions (A): 2 Sheep
chromosome 2
14.400 14.400 14.400
SM4 Framework (A): 2 Sheep
chromosome 2
14.600 14.600 14.600
SM4 Framework (F): 2 Sheep
chromosome 2
5.800 5.800 5.800
SM4 Framework (M): 2 Sheep
chromosome 2
20.700 20.700 20.700
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
14.400 14.400 14.400
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
6.100 6.100 6.100
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
20.400 20.400 20.400
SM4.2 Framework (A): 2 Sheep
chromosome 2
14.600 14.600 14.600
SM4.2 Framework (F): 2 Sheep
chromosome 2
5.800 5.800 5.800
SM4.2 Framework (M): 2 Sheep
chromosome 2
20.700 20.700 20.700


© The Roslin Institute 2007-2012, all rights reserved