This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011072


Marker Name:  CSN3 
Species:  Sheep
Marker Type:  RFLP
Publication ID: 9501303

PCR Primers

Primer: CCAACATATAAACCCAGGAATCC
Primer: GACATACAATACACAAGCATAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X14908

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 6 Sheep
chromosome 6
100.400 100.400 100.400
SM3 (A): 6 Sheep
chromosome 6
98.300 98.300 98.300
SM3 Best Positions (A): 6 Sheep
chromosome 6
101.900 101.900 101.900
SM3 Best Positions (F): 6 Sheep
chromosome 6
81.400 81.400 81.400
SM3 Best Positions (M): 6 Sheep
chromosome 6
121.400 121.400 121.400
SM3 Framework (F): 6 Sheep
chromosome 6
77.200 77.200 77.200
SM3 Framework (M): 6 Sheep
chromosome 6
117.400 117.400 117.400
SM4 Best Positions (A): 6 Sheep
chromosome 6
100.600 100.600 100.600
SM4 Framework (A): 6 Sheep
chromosome 6
97.200 97.200 97.200
SM4 Framework (F): 6 Sheep
chromosome 6
76.800 76.800 76.800
SM4 Framework (M): 6 Sheep
chromosome 6
115.500 115.500 115.500
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
100.600 100.600 100.600
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
81.200 81.200 81.200
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
118.600 118.600 118.600
SM4.2 Framework (A): 6 Sheep
chromosome 6
97.200 97.200 97.200
SM4.2 Framework (F): 6 Sheep
chromosome 6
76.900 76.900 76.900
SM4.2 Framework (M): 6 Sheep
chromosome 6
114.800 114.800 114.800
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
100.600 100.600 100.600
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
81.200 81.200 81.200
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
118.600 118.600 118.600
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
100.600 100.600 100.600
SMC (A): 6 Sheep
chromosome 6
103.000 103.000 103.000


© The Roslin Institute 2007-2012, all rights reserved