This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011005


Marker Name:  CD5 
Species:  Sheep
Marker Type:  RFLP
Publication ID: 7498748

PCR Primers

Primer: CAACTAGTCATTCTTGAGGGATTTTC
Primer: ATACGGAAAAAATACCAGATTAGACACT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 21 Sheep
chromosome 21
48.200 48.200 48.200
SM2 (A): 21 Sheep
chromosome 21
57.700 57.700 57.700
SM3 (A): 21 Sheep
chromosome 21
53.300 53.300 53.300
SM3 Best Positions (A): 21 Sheep
chromosome 21
52.500 52.500 52.500
SM3 Best Positions (F): 21 Sheep
chromosome 21
43.900 43.900 43.900
SM3 Best Positions (M): 21 Sheep
chromosome 21
58.800 58.800 58.800
SM3 Framework (F): 21 Sheep
chromosome 21
44.600 44.600 44.600
SM3 Framework (M): 21 Sheep
chromosome 21
59.600 59.600 59.600
SM4 Best Positions (A): 21 Sheep
chromosome 21
51.500 51.500 51.500
SM4 Framework (A): 21 Sheep
chromosome 21
51.900 51.900 51.900
SM4 Framework (F): 21 Sheep
chromosome 21
44.000 44.000 44.000
SM4 Framework (M): 21 Sheep
chromosome 21
58.000 58.000 58.000
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
51.500 51.500 51.500
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
43.300 43.300 43.300
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
57.800 57.800 57.800
SM4.2 Framework (A): 21 Sheep
chromosome 21
51.900 51.900 51.900
SM4.2 Framework (F): 21 Sheep
chromosome 21
44.000 44.000 44.000
SM4.2 Framework (M): 21 Sheep
chromosome 21
58.000 58.000 58.000
SM4.6 Best Positions (A): 21 Sheep
chromosome 21
52.800 52.800 52.800
SM4.6 Best Positions (F): 21 Sheep
chromosome 21
49.700 49.700 49.700
SM4.6 Best Positions (M): 21 Sheep
chromosome 21
55.600 55.600 55.600
SM4.7 Best Positions (A): 21 Sheep
chromosome 21
52.800 52.800 52.800
SMC (A): 21 Sheep
chromosome 21
57.700 57.700 57.700


© The Roslin Institute 2007-2012, all rights reserved