This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010978


Marker Name:  BP0034 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ATTTGAAAAGGCCTGTGAGG
Primer: TAGCTTGACTCCAACCTCTTCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 20 Sheep
chromosome 20
47.000 47.000 47.000
SM3 (A): 20 Sheep
chromosome 20
56.800 56.800 56.800
SM3 Best Positions (A): 20 Sheep
chromosome 20
63.300 63.300 63.300
SM3 Best Positions (F): 20 Sheep
chromosome 20
66.200 66.200 66.200
SM3 Best Positions (M): 20 Sheep
chromosome 20
69.100 69.100 69.100
SM3 Framework (F): 20 Sheep
chromosome 20
57.800 57.800 57.800
SM3 Framework (M): 20 Sheep
chromosome 20
62.600 62.600 62.600
SM4 Best Positions (A): 20 Sheep
chromosome 20
63.200 63.200 63.200
SM4 Framework (A): 20 Sheep
chromosome 20
60.400 60.400 60.400
SM4 Framework (F): 20 Sheep
chromosome 20
61.700 61.700 61.700
SM4 Framework (M): 20 Sheep
chromosome 20
66.100 66.100 66.100
SM4.2 Best Positions (A): 20 Sheep
chromosome 20
66.200 66.200 66.200
SM4.2 Best Positions (F): 20 Sheep
chromosome 20
70.800 70.800 70.800
SM4.2 Best Positions (M): 20 Sheep
chromosome 20
68.700 68.700 68.700
SM4.2 Framework (A): 20 Sheep
chromosome 20
60.400 60.400 60.400
SM4.2 Framework (F): 20 Sheep
chromosome 20
61.700 61.700 61.700
SM4.2 Framework (M): 20 Sheep
chromosome 20
66.100 66.100 66.100
SMC (A): 20 Sheep
chromosome 20
47.000 47.000 47.000


© The Roslin Institute 2007-2012, all rights reserved