This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010966


Marker Name:  BMS4011 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGAAGCTGACATTTCCACATG
Primer: CTTCCAGGCAACTAAATCAACC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18510

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 1 Sheep
chromosome 1
288.400 288.400 288.400
SM3 Best Positions (F): 1 Sheep
chromosome 1
267.400 267.400 267.400
SM3 Best Positions (M): 1 Sheep
chromosome 1
316.500 316.500 316.500
SM4 Best Positions (A): 1 Sheep
chromosome 1
287.800 287.800 287.800
SM4 Framework (A): 1 Sheep
chromosome 1
282.300 282.300 282.300
SM4 Framework (F): 1 Sheep
chromosome 1
260.600 260.600 260.600
SM4 Framework (M): 1 Sheep
chromosome 1
308.500 308.500 308.500
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
284.600 284.600 284.600
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
260.500 260.500 260.500
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
315.600 315.600 315.600
SM4.2 Framework (A): 1 Sheep
chromosome 1
282.200 282.200 282.200
SM4.2 Framework (F): 1 Sheep
chromosome 1
261.400 261.400 261.400
SM4.2 Framework (M): 1 Sheep
chromosome 1
307.800 307.800 307.800
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
277.200 277.200 277.200
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
250.100 250.100 250.100
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
310.700 310.700 310.700
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
277.900 277.900 277.900


© The Roslin Institute 2007-2012, all rights reserved